wu:fc06c01

Ensembl ID:
ENSDARG00000077790
ZFIN ID:
ZDB-GENE-030131-2374
Human Orthologue:
DCAF15
Human Description:
DDB1 and CUL4 associated factor 15 [Source:HGNC Symbol;Acc:25095]
Mouse Orthologue:
Dcaf15
Mouse Description:
DDB1 and CUL4 associated factor 15 Gene [Source:MGI Symbol;Acc:MGI:2684420]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39703 Nonsense Mutation detected in F1 DNA During 2018
sa30589 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39703
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108601 Nonsense 169 629 5 13
Genomic Location (Zv9):
Chromosome 1 (position 54643843)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 53417346
GRCz11 1 54077089
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGCCCTGATGAACATGATGATGAGTGACGAGAACAACAGAGACATTTA[C/A]ATCACCATCACTTCCATGCCTCCCGCTCAGCCGTGTAAACAGTGCTGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30589
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108601 Nonsense 494 629 9 13
Genomic Location (Zv9):
Chromosome 1 (position 54648652)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 53422155
GRCz11 1 54081898
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGATTTCGAGTATCTGATAAACGAGGTGATCAGGAATGACGCTGAATG[G/A]GGATCTCAGTTCTGCTCCTTCAGTGATTATGACGTGGTCATTCTTGAGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link