zgc:193681

Ensembl ID:
ENSDARG00000077775
ZFIN ID:
ZDB-GENE-081022-24
Description:
brain and acute leukemia, cytoplasmic-like [Source:RefSeq peptide;Acc:NP_001122239]
Human Orthologue:
BAALC
Human Description:
brain and acute leukemia, cytoplasmic [Source:HGNC Symbol;Acc:14333]
Mouse Orthologue:
Baalc
Mouse Description:
brain and acute leukemia, cytoplasmic Gene [Source:MGI Symbol;Acc:MGI:1928704]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32111 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32111
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111383 Nonsense 16 133 1 3
Genomic Location (Zv9):
Chromosome 16 (position 56374847)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 52885538
GRCz11 16 52771281
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGATGGGCTGCGGGGGAAGCAGATCCGCCACGATTGAGCCCCGTTATTA[C/A]GAGAGCAGAGACACCGAGTCTACGTGGCTGACAAACACGGACACGGAACG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link