Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:busm1-64d20.2
- Ensembl ID:
- ENSDARG00000077773
- ZFIN ID:
- ZDB-GENE-040724-240
- Description:
- Si:busm1-64d20.2 protein [Source:UniProtKB/TrEMBL;Acc:A8WGC5]
- Human Orthologue:
- ENPP7
- Human Description:
- ectonucleotide pyrophosphatase/phosphodiesterase 7 [Source:HGNC Symbol;Acc:23764]
- Mouse Orthologue:
- Enpp7
- Mouse Description:
- ectonucleotide pyrophosphatase/phosphodiesterase 7 Gene [Source:MGI Symbol;Acc:MGI:3027917]
Alleles
There is 1 allele of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa35335 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa35335
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000075564 | Essential Splice Site | 469 | 488 | 5 | 6 |
- Genomic Location (Zv9):
- Chromosome 12 (position 34389842)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 32308808 GRCz11 12 32423710 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTGGTTGTCACATCCTACAACGGATATAAAAAGCACAAACTGTATTCAAA[G/A]TAGGGCACAAAGCTACATTAACACATTATTTTTTGGGACAGTTTCTTCCC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
