wu:fi05d05

Ensembl ID:
ENSDARG00000077769
ZFIN ID:
ZDB-GENE-030131-5596
Description:
cbp/p300-interacting transactivator 1 [Source:RefSeq peptide;Acc:NP_001108363]
Human Orthologue:
CITED1
Human Description:
Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 1 [Source:HGNC Symbo
Mouse Orthologue:
Cited1
Mouse Description:
Cbp/p300-interacting transactivator with Glu/Asp-rich carboxy-terminal domain 1 Gene [Source:MGI Sym

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41020 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa41020
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109055 Nonsense 43 143 2 2
Genomic Location (Zv9):
Chromosome 7 (position 53099195)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 51368945
GRCz11 7 51644015
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCTCCATTCTAGTTCCCCGGTATTGGCCAAACCCCAGCCTTTCTGCCTA[C/T]AGTCCGGCCCACACCTCATAGCCTCCATGCAGCTTCAGAAACTCAACAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link