si:ch211-261c8.3

Ensembl ID:
ENSDARG00000077768
ZFIN ID:
ZDB-GENE-070705-156
Human Orthologue:
MALT1
Human Description:
mucosa associated lymphoid tissue lymphoma translocation gene 1 [Source:HGNC Symbol;Acc:6819]
Mouse Orthologue:
Malt1
Mouse Description:
mucosa associated lymphoid tissue lymphoma translocation gene 1 Gene [Source:MGI Symbol;Acc:MGI:2445

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45235 Nonsense Mutation detected in F1 DNA During 2018
sa25319 Nonsense Mutation detected in F1 DNA During 2018
sa11969 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa45235
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114532 Nonsense 114 817 3 17
ENSDART00000137534 Nonsense 114 287 4 7
ENSDART00000144351   None 487 None 8

The following transcripts of ENSDARG00000077768 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 69304336)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 65637271
GRCz11 5 66316376
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGACTTTTCTGTTTTTGTCTCACAGGAATTCAAATCCTGCTTCAGCCA[C/T]AGTCAGTATCTGTCATTGCCGGACACAACCTTCGCCTTAGCTGTTATGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25319
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114532 Nonsense 401 817 11 17
ENSDART00000137534   None 287 None 7
ENSDART00000144351 Nonsense 71 487 2 8

The following transcripts of ENSDARG00000077768 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 69316281)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 65649216
GRCz11 5 66328321
KASP Assay ID:
554-7448.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCACTTTTACCCTTTTGACATTTACTCATCTCCGTAGGTTTGTTGTATTA[C/A]GCTGGACATGGTTATGAGAACTTTGGGAACAGCTTCATGGTGCCAGTCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11969
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114532 Essential Splice Site 456 817 12 17
ENSDART00000137534   None 287 None 7
ENSDART00000144351 Essential Splice Site 126 487 3 8

The following transcripts of ENSDARG00000077768 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 69316518)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 65649453
GRCz11 5 66328558
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTAGCAWGATAATTGATTATATTGATTCTAACACYTATTATATTGTWTY[A/T]GGAACATGCACGAWGACGCCATGCCAAACGTCATGCTCMAAGTTACAGCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link