EIF4G1 (3 of 3)

Ensembl ID:
ENSDARG00000077766
Description:
eukaryotic translation initiation factor 4 gamma, 1 [Source:HGNC Symbol;Acc:3296]
Human Orthologue:
EIF4G1
Human Description:
eukaryotic translation initiation factor 4 gamma, 1 [Source:HGNC Symbol;Acc:3296]
Mouse Orthologue:
Eif4g1
Mouse Description:
eukaryotic translation initiation factor 4, gamma 1 Gene [Source:MGI Symbol;Acc:MGI:2384784]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45554 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45554
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017474 Essential Splice Site 970 1184 24 28
Genomic Location (Zv9):
Chromosome 15 (position 44488925)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150670.1 3409
GRCz11 KN150670.1 3409
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTTTTGTGTGTGTGTGTGTTAGAGTAACTGGGTGCCACGCAGAGGAGA[T/C]CAGGGCCCGAAAACCATCGAGCAGATCCACAAGGAGGCGCAGCTGGAGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link