slc2a4rg

Ensembl ID:
ENSDARG00000077762
ZFIN ID:
ZDB-GENE-090313-332
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q8AW84]
Human Orthologue:
SLC2A4RG
Human Description:
SLC2A4 regulator [Source:HGNC Symbol;Acc:15930]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24274 Nonsense Available for shipment Available now
sa24275 Essential Splice Site Available for shipment Available now
sa19320 Nonsense Mutation detected in F1 DNA During 2018
sa9340 Nonsense Mutation detected in F1 DNA During 2018
sa12962 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24274
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088359 Nonsense 25 486 1 9
ENSDART00000132037   None 312 None 6

The following transcripts of ENSDARG00000077762 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 14703018)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 14834951
GRCz11 23 14591028
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCCGCAGCGAGCCGGCGACTGCACGCCCGAGGGGGGCTGCACCGGCCAG[C/T]GAGAGCCTGTCACTGGAAAAGCGTTCAAAACAAACACGCAGCTGCACGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24275
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088359 Essential Splice Site 288 486 5 9
ENSDART00000132037 Essential Splice Site 114 312 2 6

The following transcripts of ENSDARG00000077762 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 14825885)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 14957818
GRCz11 23 14713895
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCAGCACCTCCTCAGGGATCCAGCGCCACATCCGCACCGTCCACTTGGG[G/A]TAAGAGACACTCACACCCGTCTGTCCCGCCGTCACCAGTTACATTAATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19320
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088359 Nonsense 425 486 8 9
ENSDART00000132037 Nonsense 251 312 5 6
ENSDART00000088359 Nonsense 425 486 8 9
ENSDART00000132037 Nonsense 251 312 5 6

The following transcripts of ENSDARG00000077762 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 14839603)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 14971536
GRCz11 23 14727613
KASP Assay ID:
554-6187.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGGGCCCGATGACTCAAATCCGCACTGTCAGCATCGGTGAGAAGAGA[C/T]AACCTGTTAACCACACCACTGTCAGCAAAACACACACCAACAGCACCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9340
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088359 Nonsense 425 486 8 9
ENSDART00000132037 Nonsense 251 312 5 6
ENSDART00000088359 Nonsense 425 486 8 9
ENSDART00000132037 Nonsense 251 312 5 6

The following transcripts of ENSDARG00000077762 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 14839603)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 14971536
GRCz11 23 14727613
KASP Assay ID:
554-6187.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCAGGGCCCGAKGACTCAAATCCRCACTGTCAGCATCGGTGAGAAGAGA[C/T]AACCTGTTAACCACACCACTGTCAGCAAAACACACACCAACAGCMCCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12962
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088359 Essential Splice Site 450 486 None 9
ENSDART00000132037 Essential Splice Site 276 312 None 6

The following transcripts of ENSDARG00000077762 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 14843358)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 14975291
GRCz11 23 14731368
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTTTTAGGAGTCYTTCATTACCGCTTACTCAAATGTAATATTTTTTCC[A/T]GGAAACCCCGCGGTGAAGCYAAGAARTGTCGGAAGGTGTATGGCATGGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Crohn's disease: Genome-wide meta-analysis increases to 71 the number of confirmed Crohn's disease susceptibility loci. (View Study)
  • Ulcerative colitis: Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease. (View Study)
  • Ulcerative colitis: Meta-analysis identifies 29 additional ulcerative colitis risk loci, increasing the number of confirmed associations to 47. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link