
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
nol9
- Ensembl ID:
- ENSDARG00000077751
- ZFIN ID:
- ZDB-GENE-070629-1
- Human Orthologue:
- NOL9
- Human Description:
- nucleolar protein 9 [Source:HGNC Symbol;Acc:26265]
- Mouse Orthologue:
- Nol9
- Mouse Description:
- nucleolar protein 9 Gene [Source:MGI Symbol;Acc:MGI:1921285]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa24337 | Nonsense | Available for shipment | Available now |
sa9241 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa1022 | Nonsense | Available for shipment | Available now |
sa43985 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa24337
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000111755 | Nonsense | 22 | 713 | 1 | 12 |
ENSDART00000136941 | Nonsense | 22 | 175 | 2 | 3 |
ENSDART00000142124 | Nonsense | 22 | 713 | 2 | 13 |
- Genomic Location (Zv9):
- Chromosome 23 (position 25244410)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 25030530 GRCz11 23 24957071 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TACACAAGGTTCATTCTCGGTCCCAACAGAGGCAGCGAAATGCATCTAAA[C/T]AACATGGCAAGAATAAGTGGAACAAAAAAGTGCGCAGCCTGGACTCAACG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa9241
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000111755 | Essential Splice Site | 164 | 713 | None | 12 |
ENSDART00000136941 | Essential Splice Site | 164 | 175 | None | 3 |
ENSDART00000142124 | Essential Splice Site | 164 | 713 | None | 13 |
- Genomic Location (Zv9):
- Chromosome 23 (position 25244840)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 25030960 GRCz11 23 24957501 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CCTTGATCATACCAAGAACCGTGCAGTGTTAGTCATGAAACAAAGTCAGG[T/G]AGGTTTACAGTACTCGAATACCAGAATGTCTAAATTTTGAATTTTTAGTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa1022
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000111755 | Nonsense | 195 | 713 | 2 | 12 |
ENSDART00000136941 | None | 175 | None | 3 | |
ENSDART00000142124 | Nonsense | 195 | 713 | 3 | 13 |
- Genomic Location (Zv9):
- Chromosome 23 (position 25246709)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 25032829 GRCz11 23 24959370 - KASP Assay ID:
- 554-0926.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GGTCATGTAGAAGTGCTGGGCTTCACCATAGAGGAGGGTCAACAGCCTTA[C/A]CCTSTGTTTTCACCACCGACCCACTGCCCGCTCACTATCACGGCCTTAGG
- Associated Phenotype:
- Data not yet available
- mRNA Expression Profiling Preview:
- View complete mRNA expression profile
Region | 3' end position | 3' end strand | Adjusted p-value | Log2 fold change (mutant/sibling) | Closest Ensembl gene 3' end | Gene name | e74 Ensembl Gene ID |
---|---|---|---|---|---|---|---|
10:22244801-22245326 | 22245326 | 1 | 2.15 × 10-194 | 1.5 | 0 | npm1a | ENSDARG00000014329 |
5:25765401-25766741 | 25766741 | 1 | 6.49 × 10-79 | 2.1 | 1 | tp53 | ENSDARG00000035559 |
22:40857801-40858664 | 40858664 | 1 | 7.23 × 10-70 | -1.5 | 0 | fetub | ENSDARG00000053973 |
25:34827000-34827300 | 34827000 | -1 | 6.01 × 10-61 | 2.4 | 2 | rps27.2 | ENSDARG00000090186 |
3:32493810-32494300 | 32493810 | -1 | 6.71 × 10-57 | 1.1 | -1 | prmt1 | ENSDARG00000010246 |
Mutation Details
- Allele Name:
- sa43985
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000111755 | Essential Splice Site | 282 | 713 | 3 | 12 |
ENSDART00000136941 | None | 175 | None | 3 | |
ENSDART00000142124 | Essential Splice Site | 282 | 713 | 4 | 13 |
- Genomic Location (Zv9):
- Chromosome 23 (position 25247775)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 25033895 GRCz11 23 24960436 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTTTCTCTCCAGCTTTTCTGAACTCACTGAGCTATTCGGCCTCAACTCGG[T/C]AAATATAGTGCTATTTCAGATATTACACTCTGACATTTTAGTCACTGATG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: