zgc:165551

Ensembl ID:
ENSDARG00000077741
ZFIN ID:
ZDB-GENE-030131-6292

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11902 Essential Splice Site Available for shipment Available now
sa27757 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa11902
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111624 Essential Splice Site 228 407 5 6
Genomic Location (Zv9):
Chromosome 11 (position 18538676)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 17904242
GRCz11 11 18038877
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCARTGGTGTTGACTGCACCATTTACAGGAAGCTGTTGGGATAGTCAG[G/A]TAAGYGTGGGCAGTKAAATTTTTTTTTTTTTTTTTTTTTTTAGTTACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27757
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111624 Nonsense 381 407 6 6
Genomic Location (Zv9):
Chromosome 11 (position 18539227)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 17904793
GRCz11 11 18039428
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCCAATGCCATTTAACCCAGTGAACACTGGTTTTAAAAACCCCTTCTG[G/A]CCTCCGGTACCTCAGTCAGTCTCTAATCCTCAAAGTCTTAATTCTCCTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link