
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:dkey-189i22.3
- Ensembl ID:
- ENSDARG00000077740
- ZFIN ID:
- ZDB-GENE-091204-128
- Human Orthologue:
- B3GALTL
- Human Description:
- beta 1,3-galactosyltransferase-like [Source:HGNC Symbol;Acc:20207]
- Mouse Orthologue:
- B3galtl
- Mouse Description:
- beta 1,3-galactosyltransferase-like Gene [Source:MGI Symbol;Acc:MGI:2685903]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa27637 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa27637
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000109563 | Essential Splice Site | 210 | 310 | 6 | 8 |
ENSDART00000124348 | None | 125 | None | 4 | |
ENSDART00000138542 | Essential Splice Site | 367 | 467 | 11 | 13 |
The following transcripts of ENSDARG00000077740 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 10 (position 34726819)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 33754677 GRCz11 10 33698537 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCTATGGGCTTAGCAGGGATGGCTACAGCTACATCACAGGAGGTGGAGGG[T/C]AAGCTATGAATATGATGTGCTCAGATATTGCAATTGCTCATAATTGCTTA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: