si:dkeyp-38b6.1

Ensembl ID:
ENSDARG00000077722
ZFIN ID:
ZDB-GENE-070912-646
Description:
Novel protein similar to vertebrate protein phosphatase 2 (Formerly 2A), regulatory subunit B'', alp
Human Orthologue:
PPP2R3A
Human Description:
protein phosphatase 2, regulatory subunit B'', alpha [Source:HGNC Symbol;Acc:9307]
Mouse Orthologues:
CAAA01108492.1.1364.1, Ppp2r3a
Mouse Description:
protein phosphatase 2, regulatory subunit B'', alpha Gene [Source:MGI Symbol;Acc:MGI:2442104]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11938 Nonsense Available for shipment Available now
sa39836 Nonsense Mutation detected in F1 DNA During 2018
sa14576 Nonsense Available for shipment Available now
sa19761 Essential Splice Site Available for shipment Available now
sa9325 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa11938
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110922   None 1141 None 15
ENSDART00000131977   None 520 None 13
ENSDART00000139080 Nonsense 381 716 1 1
Genomic Location (Zv9):
Chromosome 2 (position 25394971)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 25591167
GRCz11 2 25246801
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTTACAGGCAGTTTGAAACCTATTCAGAGTGTCCCTGGTTTGTCAGCA[C/T]GAACACCTCCATCAACTAATGGGTTCTCCCATGGCAGCTTGCCTACAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39836
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110922 Nonsense 452 1141 2 15
ENSDART00000131977   None 520 None 13
ENSDART00000139080 Nonsense 472 716 1 1
Genomic Location (Zv9):
Chromosome 2 (position 25395244)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 25591440
GRCz11 2 25247074
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGGCCAGTTAAAGGGGATGGGAAGCACAGCTGTAATCTTTCGGAGTCC[A/T]GACAATACTCCAAAAGAACTACTGGCTACTCAGAGCCTAGTGGTGGTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14576
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110922 Nonsense 727 1141 4 15
ENSDART00000131977 Nonsense 104 520 2 13
ENSDART00000139080   None 716 None 1
Genomic Location (Zv9):
Chromosome 2 (position 25428557)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 25624753
GRCz11 2 25280387
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTCCACGCTTCTACTTCCCCAAAGGCCTTCMAAACTGTGCAGCCAACTA[C/A]GACGAGGCCATTGCCAAAATCGAAGCGGCYTTCACTGAGTTCGAAGAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19761
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110922 Essential Splice Site 978 1141 11 15
ENSDART00000131977 Essential Splice Site 355 520 9 13
ENSDART00000139080   None 716 None 1
Genomic Location (Zv9):
Chromosome 2 (position 25435286)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 25631482
GRCz11 2 25287116
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGTTTGTTTGGTTCCTCATTTCAGAGGAGGACAAAAAGAACCCCACAAG[G/A]TAAAAAGGCAGATGCAAATGCTGCTGTCACCAAGTTTTACTTTAGATCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9325
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110922 Nonsense 1084 1141 14 15
ENSDART00000131977 Nonsense 461 520 12 13
ENSDART00000139080   None 716 None 1
Genomic Location (Zv9):
Chromosome 2 (position 25437683)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 25633879
GRCz11 2 25289513
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTAATTGTAAGTGTGTGTGTGCGAATCAGGATTTGGATAGTGACGGTCCA[G/T]AGCCCTCAGACTGGGACAAGTATGCCTCTGAAGAGTATGAGATTCTTGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link