SNX8 (3 of 3)

Ensembl ID:
ENSDARG00000077708
Description:
sorting nexin 8 [Source:HGNC Symbol;Acc:14972]
Human Orthologue:
SNX8
Human Description:
sorting nexin 8 [Source:HGNC Symbol;Acc:14972]
Mouse Orthologue:
Snx8
Mouse Description:
sorting nexin 8 Gene [Source:MGI Symbol;Acc:MGI:2443816]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45065 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45065
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115326 Essential Splice Site 369 385 None 10
ENSDART00000142670   373 373 None 11
Genomic Location (Zv9):
Chromosome 1 (position 11075451)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 11212570
GRCz11 1 11899370
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAATACTTGGCACATTTGTCAACTCGCAAATACAAGGCCACAAAGAGG[T/A]GCGTTTCAAACAAGTCTTTTGAGACTTCTGGTTATTCTAGTCGTCGAACG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Schizophrenia: Genome-wide association study in a Swedish population yields support for greater CNV and MHC involvement in schizophrenia compared with bipolar disorder. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link