si:dkey-261l11.5

Ensembl ID:
ENSDARG00000077686
ZFIN ID:
ZDB-GENE-091118-25
Human Orthologue:
AAK1
Human Description:
AP2 associated kinase 1 [Source:HGNC Symbol;Acc:19679]
Mouse Orthologue:
Aak1
Mouse Description:
AP2 associated kinase 1 Gene [Source:MGI Symbol;Acc:MGI:1098687]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa27677 Nonsense Mutation detected in F1 DNA During 2018
sa21810 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa27677
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058622 Nonsense 88 1055 2 22
ENSDART00000134851 Nonsense 88 219 2 5
Genomic Location (Zv9):
Chromosome 10 (position 42518225)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 41221576
GRCz11 10 41143504
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGCCCTAAAGAGGATGTATGTCAACAACGAACATGACCTGCAGGTCTG[C/A]AAACGCGAGATCCAGATCATGGTGAGCATGATGAAATGTCTTCTGTGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21810
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058622 Nonsense 701 1055 16 22
ENSDART00000134851   None 219 None 5
Genomic Location (Zv9):
Chromosome 10 (position 42478839)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 41182432
GRCz11 10 41103618
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTTACTGCTTTGTAATGTTGCTCTTCTCTGGATCTCATTTAGCTGAA[C/T]GACCTGCTGATATTCTTGGCTTGGAACCTGGAGCTGGTTTGCTAGCTGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link