
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:110239
- Ensembl ID:
- ENSDARG00000077664
- ZFIN ID:
- ZDB-GENE-050417-107
- Description:
- hypothetical protein LOC550326 [Source:RefSeq peptide;Acc:NP_001017633]
- Human Orthologue:
- CTSH
- Human Description:
- cathepsin H [Source:HGNC Symbol;Acc:2535]
- Mouse Orthologue:
- Ctsh
- Mouse Description:
- cathepsin H Gene [Source:MGI Symbol;Acc:MGI:107285]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa3004 | Essential Splice Site | F2 line generated | During 2018 |
Mutation Details
- Allele Name:
- sa3004
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000007642 | Essential Splice Site | 367 | 546 | 8 | 11 |
- Genomic Location (Zv9):
- Chromosome 19 (position 44016413)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 42926215 GRCz11 19 42495652 - KASP Assay ID:
- 554-2541.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTGGAGCTTTGCCACCACTGGAACACTAGAGGGAGCACTTTTCCTGAAGG[T/C]GAAACTACAAGATTCGGATTCTGTCACAGTACTATGTACCKAGTTCAGCG
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Bipolar disorder: Genome-wide association study on bipolar disorder in the Bulgarian population. (View Study)
- Type 1 diabetes: Genome-wide association study and meta-analysis find that over 40 loci affect risk of type 1 diabetes. (View Study)
- Type 1 diabetes: Meta-analysis of genome-wide association study data identifies additional type 1 diabetes risk loci. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: