
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-102c2.5
- Ensembl ID:
- ENSDARG00000077653
- ZFIN ID:
- ZDB-GENE-081104-97
- Human Orthologues:
- AP005242.1, C9orf86
- Human Description:
- chromosome 9 open reading frame 86 [Source:HGNC Symbol;Acc:24703]
- Mouse Orthologue:
- B230208H17Rik
- Mouse Description:
- RIKEN cDNA B230208H17 gene Gene [Source:MGI Symbol;Acc:MGI:2442633]
Alleles
There are 5 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa38472 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa40434 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa40435 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa726 | Essential Splice Site | Available for shipment | Available now |
sa38473 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa38472
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000111019 | Nonsense | 27 | 710 | 1 | 16 |
ENSDART00000142753 | Nonsense | 27 | 765 | 2 | 16 |
- Genomic Location (Zv9):
- Chromosome 5 (position 28451769)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 26207067 GRCz11 5 26807220 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCTCTGAGCCGGTTGGTCCTATAAAGGACAAGAACATCCCTGCTGGCCTA[C/T]AGTCTATGAACCAGAGTCTGCAGAGAAGATTCGCTAAAGGGGTTCAGTAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa40434
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000111019 | Nonsense | 225 | 710 | 7 | 16 |
ENSDART00000142753 | Nonsense | 223 | 765 | 8 | 16 |
- Genomic Location (Zv9):
- Chromosome 5 (position 28459394)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 26214692 GRCz11 5 26814845 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TATATCCATTATGCAGAATCTTCCATGAAGAACGGCTTTGGTTTGAAATA[T/G]TTGCACAGATTTTTCAACATTCCATTCTTGCAGCTTCAGGTAAGCAGGTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa40435
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000111019 | Nonsense | 236 | 710 | 7 | 16 |
ENSDART00000142753 | Nonsense | 234 | 765 | 8 | 16 |
- Genomic Location (Zv9):
- Chromosome 5 (position 28459425)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 26214723 GRCz11 5 26814876 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACGGCTTTGGTTTGAAATATTTGCACAGATTTTTCAACATTCCATTCTTG[C/T]AGCTTCAGGTAAGCAGGTTGATGTTTTAGTATTTTGTCTGTTGTATAATT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa726
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000111019 | Essential Splice Site | 325 | 710 | 10 | 16 |
ENSDART00000142753 | 354 | 765 | 10 | 16 |
- Genomic Location (Zv9):
- Chromosome 5 (position 28461391)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 26216689 GRCz11 5 26816842 - KASP Assay ID:
- 554-0633.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CCTYCTCTCTCCACCAGCCAAGCTCCCRCGGYGTCTCCCTCCCCATCCCC[G/A]TCCCCTGCTCACCCCGGCCCAGCAGTCTCTGCTGCTCAGGCTCCTGCTCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa38473
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000111019 | Essential Splice Site | 423 | 710 | 12 | 16 |
ENSDART00000142753 | Essential Splice Site | 453 | 765 | 12 | 16 |
- Genomic Location (Zv9):
- Chromosome 5 (position 28465381)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 26220679 GRCz11 5 26820832 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGGAATAAAACAAGTTCAATTTGCATCTATTCTTGTATCGTGTTTGTTTT[A/G]GTGAAGGGGAAGGAAGAGAAGGCAATCCCATGGTTGCTGGCTTCCAGGAT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: