zgc:171965

Ensembl ID:
ENSDARG00000077638
ZFIN ID:
ZDB-GENE-070820-20
Description:
hypothetical protein LOC100124597 [Source:RefSeq peptide;Acc:NP_001096094]
Human Orthologue:
F2R
Human Description:
coagulation factor II (thrombin) receptor [Source:HGNC Symbol;Acc:3537]
Mouse Orthologue:
F2r
Mouse Description:
coagulation factor II (thrombin) receptor Gene [Source:MGI Symbol;Acc:MGI:101802]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7489 Missense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa7489
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112403 Missense 323 391 3 3
Genomic Location (Zv9):
Chromosome 21 (position 7246909)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 7368122
GRCz11 21 7973343
KASP Assay ID:
554-4188.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTGATCATGACTATCTCTGTGCTGAGTGAGTTTGTGGTGTGTTTTGCT[C/T]CAACRAATGGCAYCTTGYTGTATCRCTGTGTTMGATTAGCAAGAAGAGGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link