zgc:175142

Ensembl ID:
ENSDARG00000077623
ZFIN ID:
ZDB-GENE-081205-4
Description:
slingshot 2-like [Source:RefSeq peptide;Acc:NP_001128575]
Human Orthologue:
SSH2
Human Description:
slingshot homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:30580]
Mouse Orthologue:
Ssh2
Mouse Description:
slingshot homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2679255]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16355 Essential Splice Site Available for shipment Available now
sa43713 Essential Splice Site Mutation detected in F1 DNA During 2018
sa9803 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16355
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113436 Essential Splice Site 321 1165 10 16
ENSDART00000137444 Essential Splice Site 321 1016 10 15

The following transcripts of ENSDARG00000077623 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 39298553)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 40438618
GRCz11 21 40462171
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YTTGGGGCAGATGGACAGGCCCACAAAGATTTTTGAGCATGTTTACCTGG[T/C]GAGAGCGACGTCTCCTTTACGTTTTAATCATACATATCAGTTATAAGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43713
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113436 Essential Splice Site 386 1165 13 16
ENSDART00000137444 Essential Splice Site 386 1016 13 15

The following transcripts of ENSDARG00000077623 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 39301327)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 40441392
GRCz11 21 40464945
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTATTAGCACTATGTCCATCTTTTAACACAAGACTAATCTGATTCCTCCA[G/T]AAAAGCCGGAGCGAAGTGTCTTGTGCACTGCAAGATGGGTGTTAGTCGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9803
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113436 Nonsense 919 1165 15 16
ENSDART00000137444 Nonsense 919 1016 15 15

The following transcripts of ENSDARG00000077623 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 39311368)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 40451433
GRCz11 21 40474986
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACACCGGCCTCACACACTCGAGACAAAGCCATTCGCACTCGTCCAGTTG[C/A]TCTCCGCCTCTGGTTCTCCAGCTCGAGGGCATCACAGAGCAGGAGAGTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link