wu:fk30a05

Ensembl ID:
ENSDARG00000077618
ZFIN ID:
ZDB-GENE-030131-8871
Human Orthologue:
RIN3
Human Description:
Ras and Rab interactor 3 [Source:HGNC Symbol;Acc:18751]
Mouse Orthologue:
Rin3
Mouse Description:
Ras and Rab interactor 3 Gene [Source:MGI Symbol;Acc:MGI:2385708]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23128 Nonsense Available for shipment Available now
sa11292 Nonsense Available for shipment Available now
sa19181 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa23128
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109801 Nonsense 169 1048 1 9
Genomic Location (Zv9):
Chromosome 17 (position 33662184)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 33503915
GRCz11 17 33456426
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTGATCAAGACGTGTCCGGTGTGGCTTCAGTTGGGGATGAATTTGGAC[A/T]AAGCCATGCATATACTGAGCAAGGAGTTCCCTGGGGTAAGAGAGAATAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11292
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109801 Nonsense 354 1048 5 9
ENSDART00000109801 Nonsense 354 1048 5 9
Genomic Location (Zv9):
Chromosome 17 (position 33671416)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 33513147
GRCz11 17 33465658
KASP Assay ID:
2261-1313.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCTGTTTTGAGGACCCAGAGTCTCAACACACCACTCCAAGCTCCACCT[A/T]AATTTAAAAGGCCTCCACCCCTCCGCCCTCGTCCTCCCAGCACACCCGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19181
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109801 Nonsense 354 1048 5 9
ENSDART00000109801 Nonsense 354 1048 5 9
Genomic Location (Zv9):
Chromosome 17 (position 33671416)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 33513147
GRCz11 17 33465658
KASP Assay ID:
2261-1313.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCTGTTTTGAGGACCCAGAGTCTCAACACACCACTCCAAGCTCCACCT[A/T]AATTTAAAAGGCCTCCACCCCTCCGCCCTCGTCCTCCCAGCACACCCGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link