
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
FRRS1 (3 of 3)
- Ensembl ID:
- ENSDARG00000077605
- Description:
- ferric-chelate reductase 1 [Source:HGNC Symbol;Acc:27622]
- Human Orthologue:
- FRRS1
- Human Description:
- ferric-chelate reductase 1 [Source:HGNC Symbol;Acc:27622]
- Mouse Orthologue:
- Frrs1
- Mouse Description:
- ferric-chelate reductase 1 Gene [Source:MGI Symbol;Acc:MGI:108076]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa24521 | Nonsense | Available for shipment | Available now |
sa17074 | Nonsense | Available for shipment | Available now |
sa24522 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa24521
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000100092 | Nonsense | 201 | 562 | 6 | 19 |
ENSDART00000113304 | Nonsense | 208 | 597 | 5 | 17 |
- Genomic Location (Zv9):
- Chromosome 24 (position 30804977)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 24 29913629 GRCz11 24 29919035 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATTTTCTCGTCAGTTCACAGCTGATGGCTGTGGAATCGAGAAGTCCTGTT[T/A]GAGAGATCCAGAGGGCTGTGAACCACAAAATGACGCTGCGTGTCACTTCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa17074
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000100092 | Nonsense | 290 | 562 | 9 | 19 |
ENSDART00000113304 | Nonsense | 305 | 597 | 9 | 17 |
- Genomic Location (Zv9):
- Chromosome 24 (position 30806189)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 24 29914841 GRCz11 24 29920112 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AATGTTYTAAAAGACAGGGCTTGGAGGCTATCAGATGGAGTGATTCAGTG[T/A]AGCTTTCGCAGAGACGTTCATCAGCCGCCTGAAGATCTGAACAGATTCAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa24522
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000100092 | Nonsense | 436 | 562 | 13 | 19 |
ENSDART00000113304 | Nonsense | 451 | 597 | 13 | 17 |
- Genomic Location (Zv9):
- Chromosome 24 (position 30810191)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 24 29918843 GRCz11 24 29924112 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGAGTCTAATCCATTTTGTGTTGTTCACAGCGGGCAGGAATACACCCGTA[T/A]TTGGGTTGTGTTGTCATGGCACTGACTCTCATCCAACCTGTCATGGCACT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- White matter integrity (interaction): White matter integrity as an intermediate phenotype: exploratory genome-wide association analysis in individuals at high risk of bipolar disorder. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: