zgc:171763

Ensembl ID:
ENSDARG00000077582
ZFIN ID:
ZDB-GENE-070928-30
Description:
hypothetical protein LOC100126016 [Source:RefSeq peptide;Acc:NP_001099166]
Human Orthologue:
ANK3
Human Description:
ankyrin 3, node of Ranvier (ankyrin G) [Source:HGNC Symbol;Acc:494]
Mouse Orthologue:
Ank3
Mouse Description:
ankyrin 3, epithelial Gene [Source:MGI Symbol;Acc:MGI:88026]

Alleles

There are 10 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22032 Essential Splice Site Available for shipment Available now
sa41965 Nonsense Mutation detected in F1 DNA During 2018
sa22031 Essential Splice Site Available for shipment Available now
sa35212 Nonsense Mutation detected in F1 DNA During 2018
sa22030 Nonsense Available for shipment Available now
sa16119 Nonsense Available for shipment Available now
sa8513 Nonsense Mutation detected in F1 DNA During 2018
sa4451 Nonsense F2 line generated During 2018
sa41964 Nonsense Mutation detected in F1 DNA During 2018
sa35211 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa22032
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088100 Essential Splice Site 394 3888 10 39
Genomic Location (Zv9):
Chromosome 12 (position 8433762)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 7737360
GRCz11 12 7771343
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATGGAGCTGCTGCTGAAACACGGAGCGTCCATTCAGGCTGTGACTGAG[G/C]TGAGTAGAGAGAGAGTTTGCTTGAACGTGAAATAACACTGGATGTAGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41965
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088100 Nonsense 1107 3888 28 39
Genomic Location (Zv9):
Chromosome 12 (position 8338951)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 7642639
GRCz11 12 7676865
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATCACTAAGGACTTCCCACAATACTTTGCGGTTGTATCACGGATCAAA[C/T]AGGAGAGTAATCAGATGGGTCCTGATGGAGGCGTCCTGTCCAGCATGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22031
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088100 Essential Splice Site 1323 3888 31 39
Genomic Location (Zv9):
Chromosome 12 (position 8334007)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 7637689
GRCz11 12 7671812
KASP Assay ID:
2260-4969.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAACAACAGGAAAACTTTGAGGAGGTGGCCAGAAGCAAAGACATAGAG[G/A]TAGATATATTTTAATGTGATTTTTCTAAACCTTTCATGATGAATATTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35212
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088100 Nonsense 1818 3888 36 39
Genomic Location (Zv9):
Chromosome 12 (position 8325438)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 7629120
GRCz11 12 7663243
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCAGACACACAACCAAACACAGTCCTCTACAACACGAAAGAAACCTGCA[A/T]AGCCCTCACTTTTCATTTCTCCAACAGTCCTCAAAGCAGCAGCCACACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22030
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088100 Nonsense 1906 3888 36 39
Genomic Location (Zv9):
Chromosome 12 (position 8325174)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 7628856
GRCz11 12 7662979
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTCGAGAAAGTTAAAGAGGACCTTGTCAAAGTTAGTGAAATTCTTAAG[A/T]AAGATGTTCTGAGTGAGGCCAAAAACTCTCGAAAAGAGAGGGCATCAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16119
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088100 Nonsense 1937 3888 36 39
Genomic Location (Zv9):
Chromosome 12 (position 8325081)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 7628763
GRCz11 12 7662886
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATCAGAAGATGAATGGGAAGAGTTCTCTAAAGATGAAATTGAGGAGGCA[C/T]GACACAGTGCCCTGCGATCCCTGCCAACATTCGAATCAASACTTCCAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8513
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088100 Nonsense 2615 3888 36 39
Genomic Location (Zv9):
Chromosome 12 (position 8323047)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 7626729
GRCz11 12 7660852
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAAGACATCTAAAGTGAGTTCTTTTAGGCAGAAGTTTGAAACAGAAGCA[C/T]AGAAACAGGATAAGAATMTACCTATAGCACAATCCAAAAAATCACCAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4451
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088100 Nonsense 2992 3888 36 39
Genomic Location (Zv9):
Chromosome 12 (position 8321916)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 7625598
GRCz11 12 7659721
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTATTACAAGCCCGATAGCTGAGGTTTCAGAAGAATCTGAAGATAGTGAA[C/T]AAGGTAAAGATCATTCTTTGAAAAAATCTGGACCAGAAGTTCAGGAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41964
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088100 Nonsense 3183 3888 36 39
Genomic Location (Zv9):
Chromosome 12 (position 8321343)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 7625025
GRCz11 12 7659148
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGACTCACTGGATGGATATGAACTTCAGGATGAGGATGATGGCTTAAGT[G/T]AACCTATAGCCAAACCTTTTGGATTTCCCAATGACAACAGAAAAGACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35211
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088100 Nonsense 3284 3888 36 39
Genomic Location (Zv9):
Chromosome 12 (position 8321039)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 7624721
GRCz11 12 7658844
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGTTTAATACTCCTTTTAAAACTGTTGCAACAAAAGGCTTTGATCCTT[G/A]GTCAAGCAAGGGAGGAGAAGATGAAGTAGTGGATGCTAGAATTAAAGACG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link