si:dkeyp-100a5.1

Ensembl ID:
ENSDARG00000077577
ZFIN ID:
ZDB-GENE-090313-372
Human Orthologue:
NTSR1
Human Description:
neurotensin receptor 1 (high affinity) [Source:HGNC Symbol;Acc:8039]
Mouse Orthologue:
Ntsr1
Mouse Description:
neurotensin receptor 1 Gene [Source:MGI Symbol;Acc:MGI:97386]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18670 Splice Site, Nonsense Available for shipment Available now
sa24279 Essential Splice Site Available for shipment Available now
sa24280 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18670
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112436 Splice Site, Nonsense 222 400 1 4
ENSDART00000132898   None 113 None 2
Genomic Location (Zv9):
Chromosome 23 (position 16602081)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 16505020
GRCz11 23 16431363
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATATATATGTACAACCATCGTGTCCTCGATAACTGCTAAWACCGTCCTA[C/T]AGGTGAGCGCTGTTATATGYTTGCAGGAGTGAAAAYGTCTTTACATTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24279
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112436 Essential Splice Site 223 400 2 4
ENSDART00000132898   None 113 None 2
Genomic Location (Zv9):
Chromosome 23 (position 16640322)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 16543261
GRCz11 23 16469604
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGTCTGCCCATTGTGTACTTATCCCTCTTTATTTTCTGTATTTCCTCAA[G/A]TTGAATGCCTTCCTGTCATTTGTGGTCCCCATGGCACTGATCTCAGCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24280
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112436 Nonsense 379 400 4 4
ENSDART00000132898 Nonsense 92 113 2 2
Genomic Location (Zv9):
Chromosome 23 (position 16696348)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 16599287
GRCz11 23 16525630
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTACCTAATCCTGCCATGCCGCCATAAGAAGCAGAAGCGCGTTCTTACC[A/T]GACACTCTATCAGCATCTGCAGCAACCAGACCTTTTCCACCAATGTCATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link