zgc:162212

Ensembl ID:
ENSDARG00000077555
ZFIN ID:
ZDB-GENE-030131-8941
Description:
hypothetical protein LOC100004969 [Source:RefSeq peptide;Acc:NP_001082814]
Human Orthologue:
FAM176B
Human Description:
family with sequence similarity 176, member B [Source:HGNC Symbol;Acc:25558]
Mouse Orthologue:
Fam176b
Mouse Description:
family with sequence similarity 176, member B Gene [Source:MGI Symbol;Acc:MGI:1922063]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36211 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa36211
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106313 Essential Splice Site None 167 2 4
ENSDART00000128254   None 167 None 2
Genomic Location (Zv9):
Chromosome 16 (position 39866473)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 35999814
GRCz11 16 35952689
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCCTGATCCCTCCGAAACAACATGAAGAGAATCTGACCACTTTATATG[G/A]TAAATCTCACTTTACTGTTGCTTTTTTTGTAATTTTTGTTGTTGCCTGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link