zgc:172324

Ensembl ID:
ENSDARG00000077532
ZFIN ID:
ZDB-GENE-080204-114
Description:
GPI ethanolamine phosphate transferase 1 [Source:RefSeq peptide;Acc:NP_001121709]
Human Orthologue:
PIGN
Human Description:
phosphatidylinositol glycan anchor biosynthesis, class N [Source:HGNC Symbol;Acc:8967]
Mouse Orthologue:
Pign
Mouse Description:
phosphatidylinositol glycan anchor biosynthesis, class N Gene [Source:MGI Symbol;Acc:MGI:1351629]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12721 Nonsense Available for shipment Available now
sa45830 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa12721
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004013 Nonsense 257 681 7 28
ENSDART00000084954 Nonsense 259 932 7 29
ENSDART00000129028 Nonsense 259 932 6 28
Genomic Location (Zv9):
Chromosome 24 (position 24317437)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 23564315
GRCz11 24 23709489
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTGTCACTGTGATGGATGACTTTTATGGCCATGATGGAAAAACGGCTTA[T/A]GTTTTTACTTCYGACCATGGCATGACAAATTGGGGTAAAACATCTCTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45830
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004013 Essential Splice Site 372 681 11 28
ENSDART00000084954 Essential Splice Site 374 932 11 29
ENSDART00000129028 Essential Splice Site 374 932 10 28
Genomic Location (Zv9):
Chromosome 24 (position 24315348)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 23562226
GRCz11 24 23707400
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCTGAGAGCATGTATGCAAATGCTATTCAGATCTTGGAGCAGTTCAGG[G/A]TAAAGTATAGTACATTTCAGTTCATTCTGGTTGGTTTATTTAAATTAGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link