zgc:100909

Ensembl ID:
ENSDARG00000077526
ZFIN IDs:
ZDB-GENE-040808-6, ZDB-GENE-040808-6
Description:
BRCA1-A complex subunit MERIT40 [Source:UniProtKB/Swiss-Prot;Acc:Q6AXK4]
Human Orthologue:
C19orf62
Human Description:
chromosome 19 open reading frame 62 [Source:HGNC Symbol;Acc:25008]
Mouse Orthologue:
5430437P03Rik
Mouse Description:
RIKEN cDNA 5430437P03 gene Gene [Source:MGI Symbol;Acc:MGI:1915501]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14436 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14436
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008980 Essential Splice Site 304 396 None 11
ENSDART00000122262 Essential Splice Site 304 370 None 10
Genomic Location (Zv9):
Chromosome 11 (position 6091826)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 6060009
GRCz11 11 6057264
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCCTTCATAATGGAACTGAAGAGCAGACAGAGGACACCAGCTGGAAGG[T/A]CTGAGCATGAAAAGCTAAAACCCTCCCAAATGATGTTTAAWGCACTGAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Breast cancer: A locus on 19p13 modifies risk of breast cancer in BRCA1 mutation carriers and is associated with hormone receptor-negative breast cancer in the general population. (View Study)
  • Ovarian cancer: Common variants at 19p13 are associated with susceptibility to ovarian cancer. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link