zgc:174896

Ensembl ID:
ENSDARG00000077513
ZFIN ID:
ZDB-GENE-080204-75
Description:
protein phosphatase 1 regulatory subunit 3D [Source:RefSeq peptide;Acc:NP_001103882]
Human Orthologue:
PPP1R3D
Human Description:
protein phosphatase 1, regulatory (inhibitor) subunit 3D [Source:HGNC Symbol;Acc:9294]
Mouse Orthologue:
Ppp1r3d
Mouse Description:
protein phosphatase 1, regulatory subunit 3D Gene [Source:MGI Symbol;Acc:MGI:1917664]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37634 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa37634
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111729 Nonsense 72 261 2 2
ENSDART00000136046 Nonsense 96 285 2 2
Genomic Location (Zv9):
Chromosome 23 (position 12267982)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 12226784
GRCz11 23 12161754
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGACGGCTCAGCCGTAGAGCCAATGTCCGATTTGTGGACTCCTTGGGGT[T/A]GGACCTGGAAAATGTCAAGGTTTTCAAAAGTGGGGAGGATCCGTTCATCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link