si:dkey-233e3.2

Ensembl ID:
ENSDARG00000077507
ZFIN ID:
ZDB-GENE-070705-388
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B0V205]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa26332 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa26332
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109617 Nonsense 457 749 2 3
ENSDART00000142746 Nonsense 457 691 4 4
Genomic Location (Zv9):
Chromosome 4 (position 38439344)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 30269235
GRCz11 4 30223759
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTGGGAAACTGGCCTTTAAACAGCTGCAGAAAGGACAACTGATTTTCTA[C/A]AAAACAGATCTGGAGAAGTGTGGGCTAGATGTCAGGCAAGGTTCTGTGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link