Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
msh5
- Ensembl ID:
- ENSDARG00000077479
- Human Orthologues:
- MSH5, MSH5
- Human Descriptions:
- mutS homolog 5 (E. coli) [Source:HGNC Symbol;Acc:7328]
- mutS homolog 5 (E. coli) [Source:HGNC Symbol;Acc:7328]
- Mouse Orthologue:
- Msh5
- Mouse Description:
- mutS homolog 5 (E. coli) Gene [Source:MGI Symbol;Acc:MGI:1329021]
Alleles
There is 1 allele of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa45552 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa45552
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000114836 | Nonsense | 212 | 213 | 5 | 5 |
- Genomic Location (Zv9):
- Chromosome 15 (position 38575689)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 40091476 GRCz11 15 39938528 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGCTGCAGTGTCCTCATTTGCTTATGTCCACATGCTTCCACAGCCTCATC[C/T]AGCTGGGATTGATCCCTGATTCCTCGCTCCTGGCTCTACTGGTGCCATAG
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Lung cancer: Common 5p15.33 and 6p21.33 variants influence lung cancer risk. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
