wu:fe36b12

Ensembl ID:
ENSDARG00000077468
ZFIN ID:
ZDB-GENE-030131-5048
Human Orthologues:
PLSCR1, PLSCR2, PLSCR4, PLSCR5
Human Descriptions:
phospholipid scramblase 1 [Source:HGNC Symbol;Acc:9092]
phospholipid scramblase 2 [Source:HGNC Symbol;Acc:16494]
phospholipid scramblase 4 [Source:HGNC Symbol;Acc:16497]
phospholipid scramblase family, member 5 [Source:HGNC Symbol;Acc:19952]
Mouse Orthologues:
1700057G04Rik, Plscr1, Plscr2, Plscr4
Mouse Descriptions:
phospholipid scramblase 1 Gene [Source:MGI Symbol;Acc:MGI:893575]
phospholipid scramblase 2 Gene [Source:MGI Symbol;Acc:MGI:1270860]
phospholipid scramblase 4 Gene [Source:MGI Symbol;Acc:MGI:2143267]
RIKEN cDNA 1700057G04 gene Gene [Source:MGI Symbol;Acc:MGI:1925709]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24439 Essential Splice Site Available for shipment Available now
sa25205 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa24439
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112607 Essential Splice Site 38 242 1 6
Genomic Location (Zv9):
Chromosome 24 (position 5288633)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 5177126
GRCz11 24 5208913
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATCCAGGAATACCAGGCTGTCCACCAGGACTGGAGTACCTCACACAGG[T/C]CAGAACACCATCAATACCATATTCAAAATAATAAATATGTATATTGTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25205
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112607 Nonsense 201 242 5 6
Genomic Location (Zv9):
Chromosome 24 (position 5293739)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 5182232
GRCz11 24 5214019
KASP Assay ID:
554-7884.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGATGAAGTCAGTATTGGGAAGATCAGCAAACAGTGGACAGGACTCCTG[C/T]GAGAGGTGTTCACAGATTCAGACAACTTTGGCATCCAGTTTCCAATGGAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link