
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
B6E520_DANRE
- Ensembl ID:
- ENSDARG00000077437
- Description:
- Plexin A1b [Source:UniProtKB/TrEMBL;Acc:B6E520]
- Human Orthologue:
- PLXNA1
- Human Description:
- plexin A1 [Source:HGNC Symbol;Acc:9099]
- Mouse Orthologue:
- Plxna1
- Mouse Description:
- plexin A1 Gene [Source:MGI Symbol;Acc:MGI:107685]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa37762 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa37761 | Essential Splice Site | Available for shipment | Available now |
sa37760 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa14112 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa37762
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000109152 | Essential Splice Site | 283 | 1173 | 6 | 23 |
- Genomic Location (Zv9):
- Chromosome 23 (position 34715581)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 37659010 GRCz11 23 34659567 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCAGCTCTGTTGCGGTCAATATTGGACGTCACCCGTGCCACTTTAAAAAG[T/C]GAGTGTTTCTCTTCTATTCATATTTTGTGCCAAACTTCCACCACATTTTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa37761
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000109152 | Essential Splice Site | 575 | 1173 | 11 | 23 |
- Genomic Location (Zv9):
- Chromosome 23 (position 34688292)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 37631721 GRCz11 23 34686856 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCTGCAGATGGACAACCTGGAGTCCAGAGTCGCTCTCGAGTGCAAAGAAG[G/A]TGAGCTTTTGGTTATTTTTAAGTCAGGTCTCATTTGTGGCCTGCAGCTAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa37760
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000109152 | Nonsense | 1024 | 1173 | 21 | 23 |
- Genomic Location (Zv9):
- Chromosome 23 (position 34626382)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 37569811 GRCz11 23 34748766 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTTTTTCCATCCTCATTCCTGTGTGTTTTCTATATTTTACAGTTTGCCGT[T/A]AAGGTTCTGGGTGAATGTGATAAAGAATCCTCAGTTTGTGTTTGACATCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa14112
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000109152 | Nonsense | 1095 | 1173 | 22 | 23 |
- Genomic Location (Zv9):
- Chromosome 23 (position 34625577)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 37569006 GRCz11 23 34749571 - KASP Assay ID:
- 2261-8061.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CCCAGATCATCAYGCTTAACTGTTTGTCTTGCCTTCCTACAGGTATTAYT[C/A]AGACATCGCACGCATGCCTGCCATCAGTGATCAGGACATGAGTGCTTATC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Total ventricular volume: Genome-wide association with MRI atrophy measures as a quantitative trait locus for Alzheimer's disease. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: