wu:fc54b10

Ensembl ID:
ENSDARG00000077434
ZFIN ID:
ZDB-GENE-030131-3790
Human Orthologue:
MON1B
Human Description:
MON1 homolog B (yeast) [Source:HGNC Symbol;Acc:25020]
Mouse Orthologue:
Mon1b
Mouse Description:
MON1 homolog b (yeast) Gene [Source:MGI Symbol;Acc:MGI:1923231]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30660 Nonsense Mutation detected in F1 DNA During 2018
sa13661 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa30660
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110224 Nonsense 119 588 2 6
Genomic Location (Zv9):
Chromosome 11 (position 26629231)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 25458056
GRCz11 11 25695672
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTAGTGGATAATAGCAATGATGACTCTGGTGAGTTTGTTGTAACTGTTT[T/A]AGCTCGGGGGAAGATGGAAGAGCAGGGAATGGGCATGAAAGGAGCCTCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13661
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110224 Nonsense 392 588 3 6
Genomic Location (Zv9):
Chromosome 11 (position 26632818)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 25461643
GRCz11 11 25699259
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTGGACACCCATCTGCTTGCCCAGTTTTAACCCTGACTGTTATTTTTA[T/A]GCCTACATCTCCTATYTGGACCCTCCKGAATGTACTGTTTGTCTGGTTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link