zgc:195004

Ensembl ID:
ENSDARG00000077399
ZFIN ID:
ZDB-GENE-080724-6
Description:
ubiquitin associated and SH3 domain containing, B-like [Source:RefSeq peptide;Acc:NP_001122227]
Human Orthologue:
UBASH3B
Human Description:
ubiquitin associated and SH3 domain containing B [Source:HGNC Symbol;Acc:29884]
Mouse Orthologue:
Ubash3b
Mouse Description:
ubiquitin associated and SH3 domain containing, B Gene [Source:MGI Symbol;Acc:MGI:1920078]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12056 Nonsense Available for shipment Available now
sa42534 Nonsense Mutation detected in F1 DNA During 2018
sa17314 Nonsense Available for shipment Available now
sa42535 Essential Splice Site Mutation detected in F1 DNA During 2018
sa44823 Nonsense Mutation detected in F1 DNA During 2018
sa42536 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa12056
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111213 Nonsense 79 642 3 14
Genomic Location (Zv9):
Chromosome 15 (position 20266133)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 21368759
GRCz11 15 21304491
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTCTCATTTGGATGACCCGTTCCTRGATGACTCTTTACCCAGAGAGTA[T/G]GTGCTGTACCTGCGCCCCAGTGGRCCTTTACAAAACCAGCTTTCTCATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42534
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111213 Nonsense 82 642 3 14
Genomic Location (Zv9):
Chromosome 15 (position 20266142)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 21368768
GRCz11 15 21304500
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGATGACCCGTTCCTAGATGACTCTTTACCCAGAGAGTATGTGCTGTA[C/A]CTGCGCCCCAGTGGACCTTTACAAAACCAGCTTTCTCATTTCTGGCAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17314
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111213 Nonsense 428 642 9 14
Genomic Location (Zv9):
Chromosome 15 (position 20278789)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 21381415
GRCz11 15 21317147
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGAATATGCCTGCAGCTCTGCCTGCTCGGGGTGCAACACATAGGGACTA[C/A]GAAATGGATGCTCCTATAACTGTGRTTGGATCCACACAGGCTAARATAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42535
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111213 Essential Splice Site 445 642 9 14
Genomic Location (Zv9):
Chromosome 15 (position 20278842)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 21381468
GRCz11 15 21317200
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGGATGCTCCTATAACTGTGGTTGGATCCACACAGGCTAAGATAGTGG[G/A]TAGGTCTGCTTAGTGTTTTGATGTTAACATGAGTTGACCAGTTGAATTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44823
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111213 Nonsense 537 642 12 14
Genomic Location (Zv9):
Chromosome 15 (position 20281502)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 21384128
GRCz11 15 21319860
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTGCATTTCCACAGACCTCACATGCCCATCAGCAAACTAACTGTCTCC[G/T]AGGCGTATGAAACATACATTAGTCGCAGCAACCAGGTGACCAAAGACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42536
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111213 Nonsense 554 642 12 14
Genomic Location (Zv9):
Chromosome 15 (position 20281554)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 21384180
GRCz11 15 21319912
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCGTATGAAACATACATTAGTCGCAGCAACCAGGTGACCAAAGACATTT[T/A]GGCCTACTGCAAAAATAAGGGTAAGTGATTATAAATGCTGCTTCAACTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link