si:dkey-6h5.1

Ensembl ID:
ENSDARG00000077384
ZFIN ID:
ZDB-GENE-100922-8
Human Orthologue:
DNAH11
Human Description:
dynein, axonemal, heavy chain 11 [Source:HGNC Symbol;Acc:2942]
Mouse Orthologue:
Dnahc11
Mouse Description:
dynein, axonemal, heavy chain 11 Gene [Source:MGI Symbol;Acc:MGI:1100864]

Alleles

There are 15 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44849 Essential Splice Site Mutation detected in F1 DNA During 2018
sa22809 Nonsense Available for shipment Available now
sa36096 Nonsense Mutation detected in F1 DNA During 2018
sa42701 Essential Splice Site Mutation detected in F1 DNA During 2018
sa11778 Nonsense Available for shipment Available now
sa42700 Essential Splice Site Mutation detected in F1 DNA During 2018
sa42699 Nonsense Mutation detected in F1 DNA During 2018
sa22808 Nonsense Available for shipment Available now
sa39096 Nonsense Mutation detected in F1 DNA During 2018
sa39095 Missense Mutation detected in F1 DNA During 2018
sa18093 Nonsense Available for shipment Available now
sa22807 Essential Splice Site Available for shipment Available now
sa42698 Nonsense Mutation detected in F1 DNA During 2018
sa6421 Essential Splice Site Mutation detected in F1 DNA During 2018
sa22806 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa44849
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020821 Essential Splice Site 414 4362 7 83
ENSDART00000148294 Essential Splice Site 349 1936 6 35
Genomic Location (Zv9):
Chromosome 16 (position 21318270)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 19555145
GRCz11 16 19360964
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTATGCCTGGCCTTTCAAGATTGTTCAGGATTGGAATCAGTTTTCAAA[G/A]TAAGCATTTCTGATAGATTTAGTTAGAATTGTTAAGAAAAAAAGAGTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22809
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020821 Nonsense 423 4362 8 83
ENSDART00000148294 Nonsense 358 1936 7 35
Genomic Location (Zv9):
Chromosome 16 (position 21318145)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 19555020
GRCz11 16 19360839
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTTCAATCTGAATTTGTTTAAAGCTGGTCACCGTGTTCAAACCCCTCT[T/A]GGACAGAGACATCATAAAGGAATCTTTTATTCCCAAGTTCTTTGAAGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36096
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020821 Nonsense 531 4362 10 83
ENSDART00000148294 Nonsense 466 1936 9 35
Genomic Location (Zv9):
Chromosome 16 (position 21317607)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 19554482
GRCz11 16 19360301
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTACCAGGAGATGTCCTCTCTTTTGGATGAGTATGAGAAGCAGGTCTA[T/G]TTGAGATGGTGTGGTGATATTAACCATGTCTGCCAGATGAACCTCGACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42701
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020821 Essential Splice Site 1100 4362 17 83
ENSDART00000148294 Essential Splice Site 1035 1936 16 35
Genomic Location (Zv9):
Chromosome 16 (position 21310527)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 19547402
GRCz11 16 19353221
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCATAATGCGGAGGTGGTTATCATCCGCAGGAAGTGTGTAGCCTTTGAG[G/A]TGAGATACTTATTAAACAATGTCTATATTATTTGAAAGGGTGAAACTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11778
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020821 Nonsense 1553 4362 29 83
ENSDART00000148294 Nonsense 1485 1936 27 35
Genomic Location (Zv9):
Chromosome 16 (position 21280088)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 19516963
GRCz11 16 19322782
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGCTAAAGGTGTGAGTTGTTTCTTCTCAGGTTGAGCTCTGGCTGAACTG[T/A]CTGGAGGATGTGATGAAAGAGGGAGTGAGAAGATTCATAGCTGAGGCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42700
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020821 Essential Splice Site 1624 4362 29 83
ENSDART00000148294 Essential Splice Site 1556 1936 27 35
Genomic Location (Zv9):
Chromosome 16 (position 21279873)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 19516748
GRCz11 16 19322567
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGGCTGAGGGTTTTGAGACGGCACTCAGAGACTACAACAAGAAACAGG[T/G]CAGTCACATACATTATACAAACTGCACAATATTGCTATTATAACTGTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42699
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020821 Nonsense 1809 4362 33 83
ENSDART00000148294 Nonsense 1741 1936 31 35
Genomic Location (Zv9):
Chromosome 16 (position 21266571)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 19503446
GRCz11 16 19309265
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGATGAGTTTAACCGGATCGCTGTGGAAGTGCTGTCAGTGGTGGCAGTG[C/T]AAGTAAAGACCATACATGATGCCATTCGCAACCAGAGCAAAAGGTAAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22808
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020821 Nonsense 2030 4362 39 83
ENSDART00000148294   None 1936 None 35
Genomic Location (Zv9):
Chromosome 16 (position 21257458)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 19494423
GRCz11 16 19300152
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTAATGATCGTGAATAATCCTAAAGAGTATCCCTGCTTTGTCCCAAAA[C/T]AGATCCTAAAAACTCTTCACAAAACTTACTTCAACATGGGAAGGAAGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39096
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020821 Nonsense 2298 4362 44 83
ENSDART00000148294   None 1936 None 35
Genomic Location (Zv9):
Chromosome 16 (position 21251637)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 19488602
GRCz11 16 19294331
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTTCCTGTCCAGGGCTCTGTGTTTGACTTCTGCTTAGATCCTCACTCC[A/T]AACGCTTTGTGCCCTGGACCGACAGGATACCTGCTTTTGAGATGGACCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39095
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020821 Missense 2821 4362 53 83
ENSDART00000148294   None 1936 None 35

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 21211802)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 19448557
GRCz11 16 19254196
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGAAAACTGCTGGAGGTTCTTTATGAATCGAGTGCGACATCAGCTCAAGG[T/A]CTTTCTGCAGTTTTTTTTTTTTTTTTTTGTATGCACAGCAGTTATTTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18093
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020821 Nonsense 3285 4362 62 83
ENSDART00000148294   None 1936 None 35

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 21178016)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 19414771
GRCz11 16 19220410
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACAGCCATATCGCCAKCAGCTCCTTCAYGACAWGCTGATTCCTTTYCTC[A/T]GAGAACTCCGGGTATGATTTCYGCTTCACATTATTCTCAGTTGTCATTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22807
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020821 Essential Splice Site 3578 4362 None 83
ENSDART00000148294   None 1936 None 35

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 21167833)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 19404588
GRCz11 16 19210227
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTAAAGAACTTCACAATGTTAATCCCATGTACCAGTACTCCCTCAAGG[T/C]AACACACTACACATCTGCCTTATTTACAGTAGTTCAGATAAATAGCTCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42698
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020821 Nonsense 3966 4362 74 83
ENSDART00000148294   None 1936 None 35

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 21160409)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 19397164
GRCz11 16 19202803
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATACCCATTCAACAATGGAGATCTGAATATTTCAGCTAATGTTCTGTA[C/A]AACTACCTGGAGGCCAGTACCAAAGTAAGATATCACTATTCATTACCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6421
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020821 Essential Splice Site 4196 4362 None 83
ENSDART00000148294   None 1936 None 35

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 21143431)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 19380186
GRCz11 16 19185825
KASP Assay ID:
554-4894.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGTTGGAGCAGGCTGACCTTTCCTTCAACTAAAACCCTGCCTCARTGG[T/A]ATAATCACCTACATAGATCTTTCTGATACAGACAAACACTAAACCATTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22806
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020821 Nonsense 4210 4362 81 83
ENSDART00000148294   None 1936 None 35

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 21143306)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 19380061
GRCz11 16 19185700
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTGCAGGTTTAGTGATGTTCTGGCTCAGTGTCGAGAGCTGGACACATG[G/A]ACTCACGACTTTGTGTTTCCCGCCGTGGTTTGGATCTCTGGACTTTTTAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link