wu:fc09a11

Ensembl ID:
ENSDARG00000077383
ZFIN IDs:
ZDB-GENE-030131-2472, ZDB-GENE-030131-2472, ZDB-GENE-030707-4
Description:
annexin 11a isoform 2 [Source:RefSeq peptide;Acc:NP_899670]
Human Orthologue:
ANXA11
Human Description:
annexin A11 [Source:HGNC Symbol;Acc:535]
Mouse Orthologue:
Anxa11
Mouse Description:
annexin A11 Gene [Source:MGI Symbol;Acc:MGI:108481]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35446 Nonsense Available for shipment Available now
sa28085 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa35446
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057948 Nonsense 293 483 8 15
ENSDART00000101775 Nonsense 336 526 8 15

The following transcripts of ENSDARG00000077383 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 16360259)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 16180294
GRCz11 13 16311286
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTGGCCTCGCGCTCTAATGCTGAGATCCGAGAAATCAATCAAGTTTTC[A/T]AAGCTGGTGCGTACTTGACTCATATTGCTTAATTCCTTCCTTCTGCAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28085
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057948 Essential Splice Site 321 483 9 15
ENSDART00000101775 Essential Splice Site 364 526 9 15

The following transcripts of ENSDARG00000077383 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 16360499)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 16180534
GRCz11 13 16311526
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGAGACACCTCTGGACATTTCCGCAGACTTTTGGTCTCTCTTGCTCAG[G/A]TACAGTTGCTGTATTTCTTAATTTATGGATTTAATAAAAATCAAAACAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link