
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
wu:fc09a11
- Ensembl ID:
- ENSDARG00000077383
- ZFIN IDs:
- ZDB-GENE-030131-2472, ZDB-GENE-030131-2472, ZDB-GENE-030707-4
- Description:
- annexin 11a isoform 2 [Source:RefSeq peptide;Acc:NP_899670]
- Human Orthologue:
- ANXA11
- Human Description:
- annexin A11 [Source:HGNC Symbol;Acc:535]
- Mouse Orthologue:
- Anxa11
- Mouse Description:
- annexin A11 Gene [Source:MGI Symbol;Acc:MGI:108481]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa35446 | Nonsense | Available for shipment | Available now |
sa28085 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa35446
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000057948 | Nonsense | 293 | 483 | 8 | 15 |
ENSDART00000101775 | Nonsense | 336 | 526 | 8 | 15 |
The following transcripts of ENSDARG00000077383 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 13 (position 16360259)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 16180294 GRCz11 13 16311286 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCTTGGCCTCGCGCTCTAATGCTGAGATCCGAGAAATCAATCAAGTTTTC[A/T]AAGCTGGTGCGTACTTGACTCATATTGCTTAATTCCTTCCTTCTGCAATT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa28085
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000057948 | Essential Splice Site | 321 | 483 | 9 | 15 |
ENSDART00000101775 | Essential Splice Site | 364 | 526 | 9 | 15 |
The following transcripts of ENSDARG00000077383 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 13 (position 16360499)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 16180534 GRCz11 13 16311526 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTGGAGACACCTCTGGACATTTCCGCAGACTTTTGGTCTCTCTTGCTCAG[G/A]TACAGTTGCTGTATTTCTTAATTTATGGATTTAATAAAAATCAAAACAAA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Chronic obstructive pulmonary disease-related biomarkers: Genome-wide association analysis of blood biomarkers in chronic obstructive pulmonary disease. (View Study)
- Sarcoidosis: Genome-wide association analysis reveals 12q13.3-q14.1 as new risk locus for sarcoidosis. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: