si:rp71-68n21.12

Ensembl ID:
ENSDARG00000077382
ZFIN ID:
ZDB-GENE-081105-169
Human Orthologues:
HCN1, HCN2, HCN3, HCN4
Human Descriptions:
hyperpolarization activated cyclic nucleotide-gated potassium channel 1 [Source:HGNC Symbol;Acc:4845
hyperpolarization activated cyclic nucleotide-gated potassium channel 2 [Source:HGNC Symbol;Acc:4846
hyperpolarization activated cyclic nucleotide-gated potassium channel 3 [Source:HGNC Symbol;Acc:1918
hyperpolarization activated cyclic nucleotide-gated potassium channel 4 [Source:HGNC Symbol;Acc:1688
Mouse Orthologues:
Hcn1, Hcn2, Hcn3, Hcn4
Mouse Descriptions:
hyperpolarization-activated, cyclic nucleotide-gated K+ 1 Gene [Source:MGI Symbol;Acc:MGI:1096392]
hyperpolarization-activated, cyclic nucleotide-gated K+ 2 Gene [Source:MGI Symbol;Acc:MGI:1298210]
hyperpolarization-activated, cyclic nucleotide-gated K+ 3 Gene [Source:MGI Symbol;Acc:MGI:1298211]
hyperpolarization-activated, cyclic nucleotide-gated K+ 4 Gene [Source:MGI Symbol;Acc:MGI:1298209]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21463 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21463
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114754 Nonsense 83 131 2 2
ENSDART00000126003   None 104 None 2
ENSDART00000131586 Nonsense 408 506 9 10
Genomic Location (Zv9):
Chromosome 9 (position 22287317)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 21443103
GRCz11 9 21253972
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTAACTGTGATATAAACTTCATCAACGGGCTTCTTGTGGAGCTGCAATA[C/A]GAGGTTTACCAGGAGGGAGACATCATCATCCGAGAGGACACCGCTGGAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link