zgc:171724

Ensembl ID:
ENSDARG00000077375
ZFIN ID:
ZDB-GENE-080204-34
Description:
Kinesin-like protein KIF22 [Source:UniProtKB/Swiss-Prot;Acc:A8WFU8]
Human Orthologue:
KIF22
Human Description:
kinesin family member 22 [Source:HGNC Symbol;Acc:6391]
Mouse Orthologue:
Kif22
Mouse Description:
kinesin family member 22 Gene [Source:MGI Symbol;Acc:MGI:109233]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35201 Nonsense Available for shipment Available now
sa22020 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35201
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114522 Nonsense 356 634 6 13
Genomic Location (Zv9):
Chromosome 12 (position 5797966)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 5025072
GRCz11 12 5060029
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCAAAGTCTAAGCAGATTGTCAATCGGCCTTTTGTCAGAGAAACTGTTT[T/A]GGCCCCTACGATTGGTGAGCAGTGCAGTTTTATCAGATATCATTTTCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22020
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114522 Nonsense 619 634 12 13
Genomic Location (Zv9):
Chromosome 12 (position 5786887)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 5036151
GRCz11 12 5071108
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTTTTGTAGGTGGAAGACCTGAAGAAAATCGAAGGTGTTACAGTTAAA[C/T]GATTCTCTTCTTTCATAAAGGTATGTTGTTTGCATCACTGATTGAGATTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link