zgc:136338

Ensembl ID:
ENSDARG00000077357
ZFIN ID:
ZDB-GENE-060616-245
Description:
leucine-rich repeat-containing protein 61 [Source:RefSeq peptide;Acc:NP_001036219]
Human Orthologue:
LRRC61
Human Description:
leucine rich repeat containing 61 [Source:HGNC Symbol;Acc:21704]
Mouse Orthologue:
Lrrc61
Mouse Description:
leucine rich repeat containing 61 Gene [Source:MGI Symbol;Acc:MGI:2652848]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14262 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14262
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108476 Essential Splice Site 170 268 5 9
Genomic Location (Zv9):
Chromosome 25 (position 26684277)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 25645332
GRCz11 25 25740410
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTGCATCCTATACAACTTTCTTTGTGACCAATGCTGCATTGCATCTAC[A/C]GTGTAGATAATCTTCATTCACTGAAGTCATTAAGGAAACTRGAGAACATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link