si:dkey-21o19.6

Ensembl ID:
ENSDARG00000077327
ZFIN ID:
ZDB-GENE-090313-245
Human Orthologue:
ANO7
Human Description:
anoctamin 7 [Source:HGNC Symbol;Acc:31677]
Mouse Orthologue:
Ano7
Mouse Description:
anoctamin 7 Gene [Source:MGI Symbol;Acc:MGI:3052714]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24326 Nonsense Available for shipment Available now
sa45801 Nonsense Mutation detected in F1 DNA During 2018
sa18464 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24326
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112370 Nonsense 420 893 11 23
ENSDART00000139514 Nonsense 175 648 5 17
ENSDART00000145489   None 199 None 5
Genomic Location (Zv9):
Chromosome 23 (position 24470358)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24256924
GRCz11 23 24183475
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTTTGATCATCCCGGGACGGTCTTCTTCAGTGTGTTCATGTCTTTGTG[G/A]GCTGTCACGTTCTTGGAGTACTGGAAACGTAAGAATGCCACTCTCGCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45801
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112370 Nonsense 592 893 15 23
ENSDART00000139514 Nonsense 347 648 9 17
ENSDART00000145489   None 198 None 5
Genomic Location (Zv9):
Chromosome 23 (position 24467965)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24254531
GRCz11 23 24181082
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAAAGTCTTCATCTTTCAGTTTGTCAACTTTTACTCATCACCTTTCTA[T/A]GTGGCCTTCTTCAAGGGCAGGTAATCTGTTAACCAGCCTAGCAAAACAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18464
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112370 Essential Splice Site 695 893 18 23
ENSDART00000139514 Essential Splice Site 450 648 12 17
ENSDART00000145489   None 199 None 5
Genomic Location (Zv9):
Chromosome 23 (position 24465571)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24252137
GRCz11 23 24178688
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTATGAGTTGATTCCCTGYGAGGGACTTTTTGACGAATATYTGGAGATTG[G/A]TAAGATGATAGTCTTTCCGCTTTTGTAAGCTTTTCATTTCTGTCAGAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link