slc45a4

Ensembl ID:
ENSDARG00000077326
ZFIN ID:
ZDB-GENE-091230-5
Human Orthologue:
SLC45A4
Human Description:
solute carrier family 45, member 4 [Source:HGNC Symbol;Acc:29196]
Mouse Orthologue:
Slc45a4
Mouse Description:
solute carrier family 45, member 4 Gene [Source:MGI Symbol;Acc:MGI:2146236]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13499 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13499
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085761 Essential Splice Site 211 794 4 8
ENSDART00000132643   None 89 None 2
Genomic Location (Zv9):
Chromosome 16 (position 33224716)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 30963231
GRCz11 16 30921158
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATAGCGAGGAACAGGATGTGGCTTTAAATATCCATGCTTTCTCAGCAK[G/A]TATTGTATATATTTTGGGACTGGGAGAGAACTGGAACAGGGATGCTCTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link