slc46a3

Ensembl ID:
ENSDARG00000077313
ZFIN ID:
ZDB-GENE-100105-2
Human Orthologue:
SLC46A3
Human Description:
solute carrier family 46, member 3 [Source:HGNC Symbol;Acc:27501]
Mouse Orthologue:
Slc46a3
Mouse Description:
solute carrier family 46, member 3 Gene [Source:MGI Symbol;Acc:MGI:1918956]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12001 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12001
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112652 Nonsense 42 475 1 6
Genomic Location (Zv9):
Chromosome 10 (position 25060605)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 24659957
GRCz11 10 24629409
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCAGTATGTATATCGTCGGCTGTGGTTTGAATTGAGCGGCTTCATCTA[T/A]ACTTCTGAGAGTCTCTCTCACTGCTCCAGCARCCACAGCTACATCACCTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link