zgc:171802

Ensembl ID:
ENSDARG00000077308
ZFIN ID:
ZDB-GENE-070928-33
Description:
G-protein coupled receptor 84 [Source:RefSeq peptide;Acc:NP_001099167]
Human Orthologue:
GPR84
Human Description:
G protein-coupled receptor 84 [Source:HGNC Symbol;Acc:4535]
Mouse Orthologue:
Gpr84
Mouse Description:
G protein-coupled receptor 84 Gene [Source:MGI Symbol;Acc:MGI:1934129]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10052 Nonsense Available for shipment Available now
sa31526 Nonsense Available for shipment Available now
sa33911 Nonsense Mutation detected in F1 DNA During 2018
sa15142 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10052
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103041 Nonsense 38 402 2 2
ENSDART00000136835 Nonsense 46 410 2 2
Genomic Location (Zv9):
Chromosome 6 (position 39048424)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39120024
GRCz11 6 39117560
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGGCTACCGTTACTTTGRTGTGCTCTTGGGATCAGCAGTGACCATAGTC[G/T]GAACTATAGGGAATATTCTCACAGTTCTCGCCTTTGTGACTGATGCCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31526
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103041 Nonsense 85 402 2 2
ENSDART00000136835 Nonsense 93 410 2 2
Genomic Location (Zv9):
Chromosome 6 (position 39048567)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39120167
GRCz11 6 39117703
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGACCTCCTATACTGCACAATACTTCAACCGGTCAGCGTTGACTCATA[T/G]CTACACCTGCACTGGAGGGGTGGAGCCACGTGGTGTCGTATGTTTGGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33911
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103041 Nonsense 204 402 2 2
ENSDART00000136835 Nonsense 212 410 2 2
Genomic Location (Zv9):
Chromosome 6 (position 39048924)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39120524
GRCz11 6 39118060
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCTTTTCCTGTACTTTTTCTTAGGCCTAGGCTTCGTAGGTCTTTTCTA[C/A]TTTCTAATCTACCGAAAAGTGAGTGTAGCCGCCAAGGCTTTTCTAAAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15142
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103041 Nonsense 285 402 2 2
ENSDART00000136835 Nonsense 293 410 2 2
Genomic Location (Zv9):
Chromosome 6 (position 39049166)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39120766
GRCz11 6 39118302
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAAGCACAGRAAGGNNNNNNNNCCACACAAAATGCCACTCAAMATGCCT[C/A]AAGTGAAACAACTAGTAAAGCATCTCCTGTAGTWATCCAGAACWCTCCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link