zgc:162289

Ensembl ID:
ENSDARG00000077307
ZFIN ID:
ZDB-GENE-070410-61
Description:
Transmembrane protein 201 [Source:UniProtKB/Swiss-Prot;Acc:A4IG66]
Human Orthologue:
TMEM201
Human Description:
transmembrane protein 201 [Source:HGNC Symbol;Acc:33719]
Mouse Orthologue:
Tmem201
Mouse Description:
transmembrane protein 201 Gene [Source:MGI Symbol;Acc:MGI:1196277]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa680 Nonsense Available for shipment Available now
sa39417 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa680
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109506 Nonsense 117 651 3 11
Genomic Location (Zv9):
Chromosome 23 (position 30092792)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 29927873
GRCz11 23 29854414
KASP Assay ID:
554-0588.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTCCCCGAGACCCCCAAGACCCTGCAGTGGGKCAACTGTCAGATGCTTT[T/A]GTGCAAGAAGTGCAACAACAACCAGACRCTGAAGATCAAGCAGCTGGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39417
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109506 Nonsense 574 651 9 11
Genomic Location (Zv9):
Chromosome 23 (position 30068915)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 29903886
GRCz11 23 29830427
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCCTATGCACAGCAGAGGATTCTTGCCTGATGTTCCACACTTCCATTTA[C/T]AAAATCATGGTATGGCGCAGTCTTGGATGTCATTCTTAAACCAGATTAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link