
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:162289
- Ensembl ID:
- ENSDARG00000077307
- ZFIN ID:
- ZDB-GENE-070410-61
- Description:
- Transmembrane protein 201 [Source:UniProtKB/Swiss-Prot;Acc:A4IG66]
- Human Orthologue:
- TMEM201
- Human Description:
- transmembrane protein 201 [Source:HGNC Symbol;Acc:33719]
- Mouse Orthologue:
- Tmem201
- Mouse Description:
- transmembrane protein 201 Gene [Source:MGI Symbol;Acc:MGI:1196277]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa680 | Nonsense | Available for shipment | Available now |
sa39417 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa680
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000109506 | Nonsense | 117 | 651 | 3 | 11 |
- Genomic Location (Zv9):
- Chromosome 23 (position 30092792)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 29927873 GRCz11 23 29854414 - KASP Assay ID:
- 554-0588.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CGTCCCCGAGACCCCCAAGACCCTGCAGTGGGKCAACTGTCAGATGCTTT[T/A]GTGCAAGAAGTGCAACAACAACCAGACRCTGAAGATCAAGCAGCTGGCCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa39417
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000109506 | Nonsense | 574 | 651 | 9 | 11 |
- Genomic Location (Zv9):
- Chromosome 23 (position 30068915)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 29903886 GRCz11 23 29830427 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATCCTATGCACAGCAGAGGATTCTTGCCTGATGTTCCACACTTCCATTTA[C/T]AAAATCATGGTATGGCGCAGTCTTGGATGTCATTCTTAAACCAGATTAAT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: