zgc:174863

Ensembl ID:
ENSDARG00000077303
ZFIN IDs:
ZDB-GENE-080204-87, ZDB-GENE-080204-87
Description:
hypothetical protein LOC100136852 [Source:RefSeq peptide;Acc:NP_001108043]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31505 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31505
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111588 Nonsense 93 290 3 7
ENSDART00000114072 Nonsense 119 316 2 5
Genomic Location (Zv9):
Chromosome 6 (position 18733224)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 22795326
GRCz11 6 19266647
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATGGGGATAAACGATTTACTCTTGAAAACCCAAGAAACGGTCCATCCT[T/A]GAAAATCACCGACACAATGTTTTCTGATGAGGGTAATTATGATTACCGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link