SYNPO2L (2 of 2)

Ensembl ID:
ENSDARG00000077293
Description:
synaptopodin 2-like [Source:HGNC Symbol;Acc:23532]
Human Orthologue:
SYNPO2L
Human Description:
synaptopodin 2-like [Source:HGNC Symbol;Acc:23532]
Mouse Orthologue:
Synpo2l
Mouse Description:
synaptopodin 2-like Gene [Source:MGI Symbol;Acc:MGI:1916010]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22279 Nonsense Available for shipment Available now
sa35468 Nonsense Mutation detected in F1 DNA During 2018
sa31924 Nonsense Available for shipment Available now
sa24931 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa22279
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108472 Nonsense 360 932 6 11
Genomic Location (Zv9):
Chromosome 13 (position 22399181)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22128519
GRCz11 13 22258969
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGATGGCATATTTCCTGGCAGTGAATCAGAATTTGATGAGGAGGGTTTTT[C/A]AGCTGCACCGGACCCCACATGGGACAGCGACTACCTTGAAATGCTGGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35468
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108472 Nonsense 617 932 8 11
Genomic Location (Zv9):
Chromosome 13 (position 22400302)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22129640
GRCz11 13 22260090
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGAGACAACTTCAAGCCCTGTAATTCCACTGTCACCTGTAGTCTATCGT[G/T]AAAAACCAGCTTCTGTTGGTGGCCGCACTGGTATTCTCCAAGATGCCCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31924
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108472 Nonsense 749 932 9 11
Genomic Location (Zv9):
Chromosome 13 (position 22400745)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22130083
GRCz11 13 22260533
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATTTCATCCAACCTCGAGAACCCTCGCCAACCCCATCCCAATGGAAGTA[T/G]TCCCCTAATGTTCGGGCTCCTCCACCCATAGGATACAATCCCTTGTTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24931
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108472 Essential Splice Site 888 932 11 11
Genomic Location (Zv9):
Chromosome 13 (position 22401360)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22130698
GRCz11 13 22261148
KASP Assay ID:
554-7452.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTCAAGTATGTCAAATCTCAGCTACTCTGGGCTCCAAGCTGCCAAACA[G/A]TTTAAGAGTGCCCCTGAATTAAGTGCCTTACCACCAAATCCCTTAAAATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link