si:dkey-222k23.4

Ensembl ID:
ENSDARG00000077257
ZFIN ID:
ZDB-GENE-080303-10
Description:
hypothetical protein LOC100142639 [Source:RefSeq peptide;Acc:NP_001116089]
Human Orthologues:
HAVCR1, HAVCR2, TIMD4
Human Descriptions:
hepatitis A virus cellular receptor 1 [Source:HGNC Symbol;Acc:17866]
hepatitis A virus cellular receptor 2 [Source:HGNC Symbol;Acc:18437]
T-cell immunoglobulin and mucin domain containing 4 [Source:HGNC Symbol;Acc:25132]
Mouse Orthologues:
BC053393, Gm12169, Havcr1, Havcr2, Timd2, Timd4
Mouse Descriptions:
cDNA sequence BC053393 Gene [Source:MGI Symbol;Acc:MGI:3039605]
hepatitis A virus cellular receptor 1 Gene [Source:MGI Symbol;Acc:MGI:2159680]
hepatitis A virus cellular receptor 2 Gene [Source:MGI Symbol;Acc:MGI:2159682]
predicted gene 12169 Gene [Source:MGI Symbol;Acc:MGI:3650838]
T-cell immunoglobulin and mucin domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:2159681]
T-cell immunoglobulin and mucin domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:2445125]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43667 Nonsense Mutation detected in F1 DNA During 2018
sa23965 Essential Splice Site Available for shipment Available now
sa23964 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa43667
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112420 Nonsense 129 259 2 7
ENSDART00000142598 Nonsense 129 259 2 7

The following transcripts of ENSDARG00000077257 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 28490928)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 29059839
GRCz11 21 29096534
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGTGGACATAGAGGGCTTCTTTAATGATAAGAAGATGTCCTACACGCTA[C/T]AAGTCATGAAAGGCAAGTTTAATGATTACTTATAAAGTTGGACAGCATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23965
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112420 Essential Splice Site 155 259 None 7
ENSDART00000142598 Essential Splice Site 155 259 None 7

The following transcripts of ENSDARG00000077257 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 28489106)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 29058017
GRCz11 21 29094712
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCTTTAGCAACAAAAAAACGATTTCCTGTGTTTCGTTCTGAATTTTGC[A/G]GCATCTCTATCAGATCCGTCCAGAGGAGGAGACTCATCACTCAATGACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23964
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112420 Nonsense 218 259 5 7
ENSDART00000142598 Nonsense 218 259 5 7

The following transcripts of ENSDARG00000077257 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 28486911)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 29055822
GRCz11 21 29092517
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTCTGTCTCTCAGTCTGCTTCTGGTTCTTTTGGGTGCTCTGGCCCTTT[T/A]GACCTTCAAACGTATGTATTGCCCTCAGCTATTATTCTACTGGACATTGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link