
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ENSDARG00000077255
- Ensembl ID:
- ENSDARG00000077255
- Human Orthologue:
- KIAA1239
- Human Description:
- KIAA1239 [Source:HGNC Symbol;Acc:29229]
- Mouse Orthologues:
- 3110047P20Rik, 3110047P20Rik
- Mouse Descriptions:
- RIKEN cDNA 3110047P20 gene Gene [Source:MGI Symbol;Acc:MGI:1920464]
- RIKEN cDNA 3110047P20 gene Gene [Source:MGI Symbol;Acc:MGI:1920464]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa43182 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa9236 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa43182
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000035305 | Nonsense | 59 | 1552 | 3 | 7 |
- Genomic Location (Zv9):
- Chromosome 18 (position 47375466)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 3069445 GRCz11 18 3025496 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTGACCCGTATGAAGCCACAAAGCCCAAAAACTGGCCTACGCAGCAGGAG[C/T]GACTGCGTATACTGGAGGACTGCTGGAACAATTCTCTACACTCTTTCTTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa9236
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000035305 | Nonsense | 577 | 1552 | 7 | 7 |
- Genomic Location (Zv9):
- Chromosome 18 (position 47368647)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 3062626 GRCz11 18 3032315 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TARCATTGTTCTGATATTTGATCATATGGAGAGRAAACATGGGAAATCTT[T/A]AGTCTCMAAAGCATTAAGCTATCTTACCWTGGCCAGGTATGGCWTGACAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: