zgc:171459

Ensembl ID:
ENSDARG00000077248
ZFIN ID:
ZDB-GENE-030131-2059
Description:
hypothetical protein LOC562056 [Source:RefSeq peptide;Acc:NP_001104635]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16305 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16305
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112746 Essential Splice Site 74 303 3 4
Genomic Location (Zv9):
Chromosome 25 (position 20157164)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 19569141
GRCz11 25 19667092
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACAGAGCAGATGGCCAAAAAGTGGGAAAACCTGAAGGCGAGATATAAGR[T/A]TTGCCCAAAAACCAATWGCATTTTTTCACCTMCAAAATGYTTCACRCAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link