
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
setd1bb
- Ensembl ID:
- ENSDARG00000077244
- ZFIN ID:
- ZDB-GENE-080522-1
- Description:
- SET domain containing 1Bb [Source:UniProtKB/TrEMBL;Acc:A5XCC1]
- Human Orthologue:
- SETD1B
- Human Description:
- SET domain containing 1B [Source:HGNC Symbol;Acc:29187]
Alleles
There are 5 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa34447 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa30902 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa41257 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa34446 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa21340 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa34447
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000114080 | Nonsense | 107 | 1789 | 3 | 23 |
- Genomic Location (Zv9):
- Chromosome 8 (position 35896608)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 34825032 GRCz11 8 34759832 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCTGAAATGTGTAAATGCTTTGGAGAGATTCAAGATTTGAAAGTTTTTTA[T/A]AATCCAAAGAACAAGAAACATTTAGGACTAGCAAAGGTTGTTTTTGAATC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa30902
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000114080 | Nonsense | 1130 | 1789 | 16 | 23 |
ENSDART00000114080 | Nonsense | 1130 | 1789 | 16 | 23 |
- Genomic Location (Zv9):
- Chromosome 8 (position 35888614)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 34817038 GRCz11 8 34751838 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GATCCAGCTCAAATGGAAGACCCAGAGGAAGAACTGAGTGTACGAGTGTA[T/A]ATGCAGGGACTAAAACTGCCTGAGCCTCTCAGATACACCTTACAGGACCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa41257
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000114080 | Nonsense | 1130 | 1789 | 16 | 23 |
ENSDART00000114080 | Nonsense | 1130 | 1789 | 16 | 23 |
- Genomic Location (Zv9):
- Chromosome 8 (position 35888614)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 34817038 GRCz11 8 34751838 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GATCCAGCTCAAATGGAAGACCCAGAGGAAGAACTGAGTGTACGAGTGTA[T/A]ATGCAGGGACTAAAACTGCCTGAGCCTCTCAGATACACCTTACAGGACCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa34446
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000114080 | Nonsense | 1296 | 1789 | 17 | 23 |
- Genomic Location (Zv9):
- Chromosome 8 (position 35886210)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 34814634 GRCz11 8 34749434 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GAACTTCCATCCTCACCCCTTTACTACGGTATTCCTCTCCTGTCATCATA[T/A]CCTGGATATGAGGAAATCCCAAAAACACCAGGCAGAGTCAATGATCCAGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa21340
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000114080 | Nonsense | 1766 | 1789 | 23 | 23 |
- Genomic Location (Zv9):
- Chromosome 8 (position 35881327)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 34809751 GRCz11 8 34744551 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATCTACTCACGACAACCTATCACTGTAAATGAAGAGATCACTTACGATTA[C/A]AAATTTCCTATTGAGGATGAGAAAATCCCCTGTCTGTGTGCTGCGGAGAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: