
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
vwf
- Ensembl ID:
- ENSDARG00000077231
- ZFIN ID:
- ZDB-GENE-070103-1
- Human Orthologue:
- VWF
- Human Description:
- von Willebrand factor [Source:HGNC Symbol;Acc:12726]
- Mouse Orthologue:
- Vwf
- Mouse Description:
- Von Willebrand factor homolog Gene [Source:MGI Symbol;Acc:MGI:98941]
Alleles
There are 8 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa10088 | Nonsense | Available for shipment | Available now |
sa270 | Nonsense | F2 line generated | During 2018 |
sa10698 | Nonsense | Available for shipment | Available now |
sa36563 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa43038 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa36564 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa39187 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa32187 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa10088
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000114690 | Nonsense | 468 | 2812 | 11 | 51 |
ENSDART00000134872 | Nonsense | 454 | 2059 | 10 | 34 |
ENSDART00000142905 | None | 444 | None | 11 |
The following transcripts of ENSDARG00000077231 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 18 (position 6250602)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 7205703 GRCz11 18 7164665 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TAAACAYGGGGGAGTGGTCTCTGTTGATGGAATGGATGTGCAAACACCCT[T/A]AATTAATGGTTTGTCAASATGYAATAATGCATACATAATTCACACTGCTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa270
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000114690 | Nonsense | 597 | 2812 | 14 | 51 |
ENSDART00000134872 | Nonsense | 583 | 2059 | 13 | 34 |
ENSDART00000142905 | None | 444 | None | 11 | |
ENSDART00000114690 | Nonsense | 597 | 2812 | 14 | 51 |
ENSDART00000134872 | Nonsense | 583 | 2059 | 13 | 34 |
ENSDART00000142905 | None | 444 | None | 11 |
The following transcripts of ENSDARG00000077231 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 18 (position 6253836)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 7208937 GRCz11 18 7167899 - KASP Assay ID:
- 554-2783.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTCTCCATGAAGTTCGAACCCTGTCATKATATGGTGAACCCTGAGCCGTA[T/G]GTGAAGAACTGCCGCTATGATGTGTGCGCATGCGCAGATGGTCAGGAGTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa10698
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000114690 | Nonsense | 597 | 2812 | 14 | 51 |
ENSDART00000134872 | Nonsense | 583 | 2059 | 13 | 34 |
ENSDART00000142905 | None | 444 | None | 11 | |
ENSDART00000114690 | Nonsense | 597 | 2812 | 14 | 51 |
ENSDART00000134872 | Nonsense | 583 | 2059 | 13 | 34 |
ENSDART00000142905 | None | 444 | None | 11 |
The following transcripts of ENSDARG00000077231 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 18 (position 6253836)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 7208937 GRCz11 18 7167899 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTCTCCATGAAGTTCGAACCCTGTCATKATATGGTGAACCCTGAGCCGTA[T/A]GTGAAGAACTGCCGCTATGATGTGTGCGCATGCGCAGATGGTCAGGAGTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa36563
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000114690 | Nonsense | 977 | 2812 | 21 | 51 |
ENSDART00000134872 | Nonsense | 963 | 2059 | 20 | 34 |
ENSDART00000142905 | None | 444 | None | 11 |
The following transcripts of ENSDARG00000077231 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 18 (position 6264075)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 7219176 GRCz11 18 7178138 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACATCTCAATTACATGGGACACGGGAACCCGAATCTCCCTGCAGATCAGC[G/T]GACAGTACAGGGTAACACACATTCATACACATGTATCAAATTAACTAAAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa43038
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000114690 | Nonsense | 1308 | 2812 | 27 | 51 |
ENSDART00000134872 | Nonsense | 1294 | 2059 | 26 | 34 |
ENSDART00000142905 | None | 444 | None | 11 |
The following transcripts of ENSDARG00000077231 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 18 (position 6269799)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 7224900 GRCz11 18 7183862 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCTCACACTCGCGCCACAGTCCTCCTCTTCCACTCTGGGGTGAAAAGTTA[C/A]GACATGCAAGTGCAGAAGTGGATCTTCAAGAAGATGGTGCGCGAGATGCG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa36564
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000114690 | Nonsense | 1632 | 2812 | 27 | 51 |
ENSDART00000134872 | Nonsense | 1618 | 2059 | 26 | 34 |
ENSDART00000142905 | None | 444 | None | 11 |
The following transcripts of ENSDARG00000077231 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 18 (position 6270769)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 7225870 GRCz11 18 7184832 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CGAGCTCCACTCATAAGAAGATCTATCCGATCGGGATCGGCCGAAAAATT[C/T]GATATGAGGATCTCGCACTGTTGAGCTTTCCGGATAAGCCAATCATGCTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa39187
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000114690 | Nonsense | 1855 | 2812 | 31 | 51 |
ENSDART00000134872 | Nonsense | 1841 | 2059 | 30 | 34 |
ENSDART00000142905 | None | 444 | None | 11 |
The following transcripts of ENSDARG00000077231 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 18 (position 6274313)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 7229414 GRCz11 18 7188376 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CACTCGCAGGCCCACAGGCTCAGGAAAACGTCATTCTGCTCGGCAGCACA[G/T]AGTATCTGCTTTCCATGGCTGCGTTTGACCAGTCCTTCCCTGACAAACTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa32187
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000114690 | Essential Splice Site | 2488 | 2812 | None | 51 |
ENSDART00000134872 | None | 2059 | None | 34 | |
ENSDART00000142905 | Essential Splice Site | 272 | 444 | None | 11 |
The following transcripts of ENSDARG00000077231 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 18 (position 6299435)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 7254536 GRCz11 18 7213498 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCACATCGCTCAGTGTGTGGACCCCGTCTGCAACCAGATCTGCCCTGTGG[T/C]GCGTCCTACACAACTCCGCCTCAGTCTGTGAGATTGAGTCATATTCACTT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Coagulation factor levels: Linkage analysis identifies a locus for plasma von Willebrand factor undetected by genome-wide association. (View Study)
- Platelet counts: New gene functions in megakaryopoiesis and platelet formation. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: