smarca4

Ensembl ID:
ENSDARG00000077226
ZFIN ID:
ZDB-GENE-030605-1
Description:
transcription activator BRG1 [Source:RefSeq peptide;Acc:NP_853634]
Human Orthologue:
SMARCA4
Human Description:
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4 [S
Mouse Orthologue:
Smarca4
Mouse Description:
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4 Ge

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12514 Nonsense Available for shipment Available now
sa19981 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12514
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111443   None 553 None 10
ENSDART00000115110 Nonsense 744 1627 14 33
ENSDART00000134514 Nonsense 744 1627 15 34
Genomic Location (Zv9):
Chromosome 3 (position 19084339)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 19112701
GRCz11 3 19262441
KASP Assay ID:
2259-3284.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACGATGAATACGGGAACTCTGCATTCATTCGGGGCCTGCAGTCATATTA[T/A]GCTGTGGCCCACGCMGTCACAGAGAAGGTGGAAARRCAATCGAGTCTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19981
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111443   None 553 None 10
ENSDART00000115110 Essential Splice Site 1140 1627 23 33
ENSDART00000134514 Essential Splice Site 1140 1627 24 34
Genomic Location (Zv9):
Chromosome 3 (position 19089867)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 19118229
GRCz11 3 19267969
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGAGGACTACTTTGCTTACCGCAACTTCAAATACCTCCGCTTAGACGG[T/C]AAGTCATGTTCCTTGTTATTTAAGGTCATTAATAGTTCATTTAAAAGCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Coronary heart disease: Genome-wide association study of coronary heart disease and its risk factors in 8,090 African Americans: the NHLBI CARe Project. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link