zgc:174622

Ensembl ID:
ENSDARG00000077222
ZFIN ID:
ZDB-GENE-080204-23
Description:
hypothetical protein LOC567635 [Source:RefSeq peptide;Acc:NP_001103504]
Human Orthologue:
TMEM130
Human Description:
transmembrane protein 130 [Source:HGNC Symbol;Acc:25429]
Mouse Orthologue:
Tmem130
Mouse Description:
transmembrane protein 130 Gene [Source:MGI Symbol;Acc:MGI:3607706]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38882 Essential Splice Site Mutation detected in F1 DNA During 2018
sa2652 Nonsense F2 line generated During 2018
sa16730 Nonsense Available for shipment Available now
sa35252 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38882
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109132 Essential Splice Site 34 318 2 8
Genomic Location (Zv9):
Chromosome 12 (position 18894985)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 17744490
GRCz11 12 17866364
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCTTGCCTTTGGGATACCAGAAGAAACCCCTCATCATCAGTTATCTGG[T/G]AAGCTGCTCCTTTTAAGGTTTTGGCTTTGTTTTTACTGGTGAAGATTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2652
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109132 Nonsense 175 318 6 8
Genomic Location (Zv9):
Chromosome 12 (position 18896026)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 17745533
GRCz11 12 17867407
KASP Assay ID:
554-3191.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTTCTCTATTGCATGTGACGNNTATAGCCCTCCGGTTTGGCTGTGCTGG[A/T]GAGTTTTGCCTGATTGCCACACACCCAATCCAGCTTCCTGCAGTTTAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16730
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109132 Nonsense 230 318 6 8
Genomic Location (Zv9):
Chromosome 12 (position 18896193)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGAGTGTGAAAAATAACATCAGCAGCCTCCAGACAKTCTACAGCRTCTA[T/A]GTGCAAAGYGGTCGTAAGTATAATWCTTTTAWACATACTGTATATAMAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35252
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109132 Essential Splice Site 234 318 6 8
Genomic Location (Zv9):
Chromosome 12 (position 18896207)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 17745714
GRCz11 12 17867588
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAACATCAGCAGCCTCCAGACATTCTACAGCGTCTATGTGCAAAGTGGTC[G/T]TAAGTATAATTCTTTTATACATACTGTATATAAAACAAGTTTTATTTTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link